clean.fasta.name.RdCleaning the names of sequences for a fasta file. The punctuation characters and the white space will be replaced with "_".
clean.fasta.name(infile = NULL, outfile = "name_cleaned.fasta")
| infile | character string representing the name of the fasta file. |
|---|---|
| outfile | Character string representing the file name to be generated. |
Punctuation characters and white space will be replaced by "_". More information can be found at regex.
This is a subroutine without a return value. A fasta file with all the names of sequences renamed will be saved to the working directory.
http://www.genomatix.de/online_help/help/sequence_formats.html
Jinlong Zhang <jinlongzhang01@gmail.com>
cat( ">seq_1*66", "--TTACAAATTGACTTATTATA", ">seq_2()r", "GATTACAAATTGACTTATTATA", ">seq_3:test", "GATTACAAATTGACTTATTATA", ">seq_588", "GATTACAAATTGACTTATTATA", ">seq_8$$yu", "GATTACAAATTGACTTATTATA", ">seq_10", "---TACAAATTGAATTATTATA", file = "matk.fasta", sep = "\n") clean.fasta.name(infile = "matk.fasta")#> name_cleaned.fasta has been saved to /Users/jinlong/Documents/github/phylotools/docs/reference #> name_cleaned.fasta has been saved to /Users/jinlong/Documents/github/phylotools/docs/reference#> [1] "seq_1_66" "seq_2__r" "seq_3_test" "seq_588" "seq_8__yu" #> [6] "seq_10"