rm.sequence.fasta.RdDelete sequences from fasta file
rm.sequence.fasta(infile, outfile = "sequence.removed.fasta", to.rm = NULL)
| infile | Character string representing the name of the fasta file. |
|---|---|
| outfile | Character string representing the name of the output fasta file. |
| to.rm | Vector of character string containing the names of sequences to be deleted. |
Delete sequences from a fasta file.
This is a subroutine without return value.
http://www.genomatix.de/online_help/help/sequence_formats.html
Jinlong Zhang <jinlongzhang01@gmail.com>
cat( ">seq_1", "---TCCGCCCCCCTACTCTA", ">seq_3", "CTCTCCGCCCCTCTACTCTA", ">seq_5", "---TCCGCCC-TTTACTCTA", ">seq_6", "---TCCGCCCCTCTACTCTA", ">seq_9", "---TCCGCCC-TCTACTCTA", ">seq_12", "CTCTCCGCCC-TCTACTCTA", file = "trn2.fasta", sep = "\n") rm.sequence.fasta(infile = "trn2.fasta", to.rm = c("seq_1","seq_12"))#> sequence.removed.fasta has been saved to /Users/jinlong/Documents/github/phylotools/docs/reference